AZS-CRIMEA-SERVICE.RU

Подвесная люстра Favourite 1729-5P


14629.5 RUR
1729-5P Favourite

Favourite / 1729-5P / похожие

Подробнее

Люстра Favourite 1729-5P Alla


Подвесная люстра Favourite производства Германия из коллекции Alla. В конструкции люстры 1729-5P используются 5 белых тканевых плафонов конусной формы и металлическая арматура цвета белый. Габаритные размеры люстры 400x560 мм. Дизайн люстры отлично подходит для спальни. Устанавливается на потолок.

14630 RUR
1729-5P Alla Favourite

Favourite / 1729-5P Alla / похожие

Подробнее

Бра Favourite 1729-2W


5169.5 RUR
1729-2W Favourite

Favourite / 1729-2W / похожие

Подробнее

Утюг MAGNIT RMI-1729


1520 RUR
RMI-1729 MAGNIT

MAGNIT / RMI-1729 / похожие

Подробнее

Бра Favourite 1729-1W


3409.5 RUR
1729-1W Favourite

Favourite / 1729-1W / похожие

Подробнее

Люстра Favourite 1352-5P


11659.5 RUR
1352-5P Favourite

Favourite / 1352-5P / похожие

Подробнее

Подвесная люстра Favourite 2356-5P


12759.5 RUR
2356-5P Favourite

Favourite / 2356-5P / похожие

Подробнее

Подвесная люстра Favourite 2452-5P


12429.5 RUR
2452-5P Favourite

Favourite / 2452-5P / похожие

Подробнее

Подвесная люстра Favourite 2149-5P


27499.5 RUR
2149-5P Favourite

Favourite / 2149-5P / похожие

Подробнее

Подвесная люстра Favourite 2553-5P


13309.5 RUR
2553-5P Favourite

Favourite / 2553-5P / похожие

Подробнее

Gallus gallus (chicken) gga-miR-1729-5p | URS000038AB65

This miRNA sequence is 23 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (MirGeneDB, miRBase, ENA, RefSeq). Described in 5 papers. Gallus gallus (chicken) gga-miR-1729-5p sequence is a product of MIR1729, gga-miR-1729, miR-1729, gga-nc-32 microRNA, nc-32 microRN, miR-1729-5p, nc-32 microRNA, gga-miR-1729-5p genes.

Postleitzahl 1729 • 11 Orte im Postleitzahlen-Bereich

Im PLZ-Gebiet 1729 leben 33.481 Einwohner auf einer Fläche von 812 qkm Übersicht aller Orte mit kostenloser Postleitzahlenkarte

1729 – Wikipedia

1729 in anderen Kalendern Armenischer Kalender: 1177/78 (Jahreswechsel Juli) Äthiopischer Kalender: 1721/22 (Jahreswechsel 10./11. September) Bengalischer Solarkalender: 1134/35 (Jahresbeginn 14. oder 15. April) Buddhistische Zeitrechnung: 2272/73 (südlicher Buddhismus); 2271/72 (Alternativberechnung nach Buddhas Parinirvana) Chinesischer Kalender: 73. (74.) Zyklus. Jahr des Erde-Hahns ...

Postleitzahl 17291 • 11 Orte im Postleitzahlengebiet

Im PLZ-Gebiet leben 33.481 Einwohner auf einer Fläche von 812,44 qkm Liste aller Orte mit Stadtteile und Straßenverzeichnis.

5120-01-534-1729 - RETAINING RING PLIERS, 5P5197 , 5P-5197 ...

5120-01-534-1729 See also PLIERS and PLIERS (as modified). Part Alternates: 5P5197 , 5P-5197, 5120-01-534-1729, 01-534-1729, 5120015341729, 015341729. Hand Tools | Hand Tools, Nonedged, Nonpowered. Supply Group (FSG) NSN Assign. NIIN Item Name Code (INC) 51: 12 OCT 2005: 01-534-1729: 19019 ( PLIERS, RETAINING RING ) Drawings & Photos | NSN 5120-01-534-1729. Cross Reference | NSN 5120-01-534 ...

1729 - Wikipedia

1729 () was a common year starting on Saturday of the Gregorian calendar and a common year starting on Wednesday of the Julian calendar, the 1729th year of the Common Era (CE) and Anno Domini (AD) designations, the 729th year of the 2nd millennium, the 29th year of the 18th century, and the 10th and last year of the 1720s decade. As of the start of 1729, the Gregorian calendar was 11 days ...

1729 (number) - Wikipedia

1729 is the natural number following 1728 and preceding 1730. It is a taxicab number, and is variously known as Ramanujan's number and the Ramanujan-Hardy number, after an anecdote of the British mathematician G. H. Hardy when he visited Indian mathematician Srinivasa Ramanujan in hospital. He related their conversation: I remember once going to see him when he was ill at Putney.

1729.5 °C in °F | 1729.5 Grad Celsius in Fahrenheit | 1729 ...

Für 1729.5 Celsius, respektive 1729.5 Grad Celsius, verwenden wir das Einheitenzeichen °C und schreiben die Temperatur als 1729.5 °C. Die Einheit Fahrenheit in abgekürzter Form lautet °F. Falls du nach 1729.5 °C in °F oder beispielsweise 1729.5 C in F gesucht hast, dann hast du gewiss den richtigen Artikel gefunden.

TargetScanHuman 6.2

References: 1) Conserved Seed Pairing, Often Flanked by Adenosines, Indicates that Thousands of Human Genes are MicroRNA Targets Benjamin P Lewis, Christopher B Burge, David P Bartel. Cell, 120:15-20 (2005). 2) Most Mammalian mRNAs Are Conserved Targets of MicroRNAs Robin C Friedman, Kyle Kai-How Farh, Christopher B Burge, David P Bartel.

Top 100 Berühmte Personen der Geschichte · geboren.am

Gotthold Ephraim Lessing (1729–1781) Katharina II. die Große (1729–1796) George Washington (1732–1799) Johann Wolfgang von Goethe (1749–1832) Wolfgang Amadeus Mozart (1756–1791) Friedrich Schiller (1759–1805) Wilhelm von Humboldt (1767–1835) Alexander von Humboldt (1769–1859) Napoleon Bonaparte (1769–1821) Ludwig van Beethoven (1770–1827) Carl Friedrich Gauß (1777–1855 ...

Kegelrollenlager · 1729 · TIMKEN online kaufen ...

Kegelrollenlager · 1729 · TIMKEN Details zu TIMKEN 1729. Menge Netto/Stück Brutto/Stück ab 1: 22,86 € 26,52 € ab 15: 21,71 € 25,18 € ab 50: 21,02 € 24,38 € ab 150: 20,11 € 23,33 € ab 350: 18,29 € 21,22 € In den Warenkorb. Technische Infos Außen: 56,90 Gewicht: ...

Continental ContiSportContact 5P 305/30 R19 102Y ...

(1729) 305/30ZR 19 102Y TL SpCont.5P RO1 XL FR AUDI QUATTRO-MODELLE/EXTRA LOAD. Lieferung Di., 10.11. - Mo., 16.11. Kostenpflichtige Rücksendung. 230,63 € Versand frei ab 2 Reifen; Einzelreifen +8,66 € in den Warenkorb (3762) Continental ContiSportContact 5P ( 305/30 ZR19 (102Y) XL RO1 ) Lieferung Di., 10.11. - Mi., 11.11. Kostenpflichtige Rücksendung. 230,66 € KOSTENLOSER Versand. in ...

miRNA Entry for MI0007468 - mirbase.org

Mature sequence gga-miR-1729-5p Accession: MIMAT0007629: Previous IDs: gga-miR-1729: Sequence: 6 - aucccuuacucacaugaguaguc - 28 Get sequence: Deep sequencing: 2714 reads, 5 experiments: Evidence: experimental; Illumina [1] Database links: RNAcentral:URS000038AB65_9031; Predicted targets: TargetScanVert:gga-miR-1729-5p; miRDB:gga-miR-1729-5p; Mature sequence gga-miR-1729-3p Accession ...

EN 1729-1:2015(2:2012+A1:2015) testing standard - Furnitest

EN 1729-2:2012+A1:2015 Furniture – Chairs and tables for educational institutions – Part 2: Safety requirements and test methods This European Standard specifies safety requirements and test methods for chairs and tables for general educational purposes in educational institutions. It applies to furniture for use with laptop computers or portable devices, but not to special purpose ...

17290 - Tillig Modellbahnen

TILLIG Modellbahnen GmbH Promenade 1 01855 Sebnitz. Tel.: +49 (0) 3 59 71/903-0 Fax: +49 (0) 3 59 71/903-19 E-Mail: info@tillig.com

1729 – Wikipédia

1729: Ab urbe condita: 2482: Bahái naptár-115 – -114: Berber naptár: 2679: Bizánci naptár: 7237 – 7238: Buddhista naptár: 2273: Burmai naptár: 1091: Dzsucse-naptár-182: Etióp naptár: 1721 – 1722: Hindu naptárak: Vikram Samvat: 1784 – 1785: Shaka Samvat: 1651 – 1652: Kali-juga: 4830 – 4831: Holocén naptár: 11729: Iráni naptár : 1107 – 1108: Japán naptár: 2389 (Jim

5120-01-534-1729, 5120015341729, 5P-5197 Data. Get Quote & Buy

5120-01-534-1729, 5120015341729,Pliers, Retaining Ring. Get a quote and buy 5120-01-534-1729 and other NSN parts. Fulfillment operation is ISO certified.

Produkte

OENORM EN 1729-2. Möbel - Stühle und Tische für Bildungseinrichtungen - Teil 2: Sicherheitstechnische Anforderungen und Prüfverfahren Ausgabe 2016-03-01. Norm-Entwurf DIN EN 61010-2-130; VDE 0411-2-130:2018-07. Sicherheitsbestimmungen für elektrische Mess-, Steuer-, Regel- und Laborgeräte - Teil 2-130: Besondere Anforderungen an Geräte, die für den Gebrauch in Bildungseinrichtungen ...

DIN EN 1729-2 - 2012-04 - Beuth.de

DIN EN 1729-2 - 2012-04 Möbel - Stühle und Tische für Bildungseinrichtungen - Teil 2: Sicherheitstechnische Anforderungen und Prüfverfahren; Deutsche Fassung EN 1729-2:2012. Jetzt informieren!

miR‑134‑5p/Foxp2/Syn1 is involved in cognitive impairment ...

miR-134-5p indirectly regulates synaptic-associated proteins by regulating Foxp2, and Syn1 is a potential downstream target of Foxp2. (A) siRNA-Foxp2-002 was the most efficient sequence for the silencing of Foxp2 expression as determined using western blotting. ***P<0.001 vs. the siR-NC group (one-way ANOVA). (B) Western blot analysis revealed that the expression of Syn1 and Snap25 was ...

DIN EN 1729-1:2016-02 (D) - KAN

DIN EN 1729-1:2016-02 (D) Möbel - Stühle und Tische für Bildungseinrichtungen - Teil 1: Funktionsmaße; Deutsche Fassung EN 1729-1:2015 Inhalt Seite Europäisches Vorwort ..... 3 Einleitung ..... 4 1 Anwendungsbereich ..... 5 2 Normative Verweisungen ..... 5 3 Begriffe ..... 5 4 Funktionsmaße für Stühle und Tische ..... 9 5 Kennzeichnung .....10 6 Anleitungen .....10 7 Zulassung des ...

IC 1729 – Wikipedia

IC 1729 ist eine Elliptische Galaxie vom Hubble-Typ E/S0 im Sternbild Fornax am Südsternhimmel.Sie ist schätzungsweise 66 Millionen Lichtjahre von der Milchstraße entfernt und hat einen Durchmesser von etwa 30.000 Lichtjahren.. Im selben Himmelsareal befindet sich u. a. die Galaxie NGC 689.. Das Objekt wurde am 8. Oktober 1896 von Lewis Swift entdeckt.

1729 – Wikipedie

1729 byl rok, který dle gregoriánského kalendáře započal sobotou.. Události. Jezuita Antonín Koniáš vydává seznam zakázaných knih; českých knih je na seznamu 1233.; 19. března – svatořečení Jana Nepomuckého; Probíhající události. 1718–1730 – Tulipánová éra 1727–1729 – Anglo-španělská válka Vědy a umění. 15. dubna (Velký pátek) – premiéra ...

1729 RO4

Top 10 FUNNIEST Auditions Of The Decade on @America's Got Talent Will Make You LOL😂 - Duration: 37:59. Talent Recap Recommended for you

1729 - Ähnliche Wörter, Verwendungen und mehr

1729 wurde er von König Friedrich Wilhelm als Fahnenjunker Von Ahlefeldt war ab 1725 Leutnant und ab 1729 Hauptmann des Kronprinzen Regiments . Von 1737 bis sein Rückkehr 1727 wurde er preußischer Fähnrich . 1729 wurde er Sekondelieutenant in Füselierregiment Dossow . Am

MECCANISMO ALZACRISTALLI ELETTRICO POSTERIORE SINISTRO R ...

Kaufen Sie MECCANISMO ALZACRISTALLI ELETTRICO POSTERIORE SINISTRO R KOLEOS 05/2008-> 5P 30/1729 im Auto & Motorrad-Shop auf Amazon.de. Große Auswahl und Gratis Lieferung durch Amazon ab 29€.

DIN EN 1729-2 - 2016-03 - Beuth.de

DIN EN 1729-2 - 2016-03 Möbel - Stühle und Tische für Bildungseinrichtungen - Teil 2: Sicherheitstechnische Anforderungen und Prüfverfahren; Deutsche Fassung EN 1729-2:2012+A1:2015. Jetzt informieren!

Propofol suppresses gastric cancer tumorigenesis by ...

Meanwhile, miR‑195‑5p inhibitor reversed the si‑circ‑PVT1‑induced low expression of ETS1. Downregulation of ETS1 induced by propofol in HGC‑27 and AGS cells could be restored by circ‑PVT1 upregulation or miR‑195‑5p silencing. Circ‑PVT1 silencing facilitated the propofol‑induced anti‑GC effect in vivo. In conclusion, the present study indicated that propofol inhibited ...

Eigenschaften der Zahl 1729 - numberempire.com

Eigenschaften der Zahl 1729: factors, prime check, fibonacci check, bell number check, binary, octal, hexadecimal representations and more.

pix11 news at 5p_041916_1729_trihonda bb on Vimeo

This is "pix11 news at 5p_041916_1729_trihonda bb" by PIX11 on Vimeo, the home for high quality videos and the people who love them.

Eigenschaften von 1729 - NumberWorld.info

Die Zahl 1729 besitzt 8 Teiler ( 1, 7, 13, 19, 91, 133, 247, 1729) mit einer Summe von 2240. Die Nummer 1729 ist keine Primzahl. 1729 ist keine Fibonacci-Zahl. Die Zahl 1729 ist keine Bellsche Zahl. Die Nummer 1729 ist keine Catalan Zahl. Die Umrechnung von 1729 zur Basis 2 (Binär) ergibt 11011000001. Die Umrechnung von 1729 zur Basis 3 (Ternär) beträgt 2101001. Die Umrechnung von 1729 zur ...

American Scientific Publishers

Tissue Eng. 10, 1719–1729 (2020) [Full Text - PDF] [Purchase Article] Volume ... and Mir-142-5p-Guided Bone Marrow Mesenchymal Stem Cells Liangle Liu, Xiuzhi Ye, Minghai Dai, Guangjie Shen, Junming Wan, and Yilong Dong J. Biomater. Tissue Eng. 10, 1503–1508 (2020) [Full Text - PDF] [Purchase Article] Effects of Long-Chain Non-Coding RNA-Small Nucleolar RNA Host Gene 1 (SNHG1) on Islet ß ...

1729

HTML-Code zum Verweis auf diese Seite: <a href="http://www.uni-protokolle.de/Lexikon/1729.html">1729 </a>

1729 (RZ) | Timelines Wikia | Fandom

Der Artikel 1729 (RZ) listet alle Medien auf die im Jahr 1729 erschienen sind. Zurück zu: Kategorie: RZ, Für eine höhere Ansicht siehe: 1720er (RZ)/ 18. Jahrhundert (RZ), Voriges Jahr: 1728 (RZ)/ Nächstes Jahr: 1730 (RZ)

Eaton's CAD - Free 3D CAD Models - PARTcommunity

Eaton's CAD 3D CAD models. No Third-party Cookies supported. Your browser does not allow setting Third-party cookies.

CERL Thesaurus

See also TA011459. - UPGRADE OF LCNA. - Born 12 Jan. 1729. Weiterführende Informationen. Weitere Lebensdaten 12.01.1729-09.07.1797. 1729-1797. 1729-1797. 12.01.1729-09.07.1797 . 1729-1797. Verfasserschaft Auteur. Muttersprache(n) English. Aktivität Personen der Geschichte (Politiker und historische Persönlichkeiten) (16.5p) (sswd) Personen zu Philosophie (4.7p) (sswd) Personen (Politologen ...

Electron-impact ionization in the xenon isonuclear ...

The distorted-wave approximation and electron-ion crossed beams have been employed to complete a theoretical and experimental study of electron-impact ionization along the Xe isonuclear sequence. Experimental results are given for Xe 2+ through Xe 6+ and the results of theoretical calculations are presented for Xe + > through Xe<SUP>6+</SUP>.

DNB, Katalog der Deutschen Nationalbibliothek

16.5p Personen der Geschichte (Politiker und historische Persönlichkeiten) ; 3.6p Personen zu Kirchengeschichte, Systematischer und Praktischer Theologie, Kirche und Konfession Typ Person (piz)

Linie Theodor Burckhardt 1549-1623

1729-1817 1738-1810 1736-1801 1734-1739-1779 1729-1808 1745-1732-Kind 1705-1771 Christoph Burckhardt Maria Elisabeth Vischer Dorothea Merian Anna Katharina Mieg Luise Charlotte Bachofen Helena Bachofen Rosina Bischoff Karolina Christina von Schwencksfeld Carolina Christina Burckhardt oo 1729 oo 1764 oo 1759 Dr. med., Arzt und Prof. 2. oo 1766 oo 1830 oo 1830 2. oo 18xx oo 1830 oo 1807 Zürich ...

CERL Thesaurus

1729-1765. Verfasserschaft Auteur. Muttersprache(n) French. Aktivität Personen der Geschichte (Politiker und historische Persönlichkeiten) (16.5p) (sswd) Thronfolger (gnd) Land Frankreich. Geographische Anmerkung FR (iso3166) Nationalität France. Wirkungsort. Geburtsort Versailles (1729) Lieu de naissance . Versailles Geburtsort ...

DNB, Katalog der Deutschen Nationalbibliothek

16.5p Personen der Geschichte (Politiker und historische Persönlichkeiten) ; 12.2p Personen zu Literaturgeschichte (Schriftsteller) ; 21.5p Personen zu Physik ; 28p Personen zu Mathematik Typ: Person (piz) Autor von: 1 Publikation. Casanova und Graf Lamberg Lamberg, Maximilian Joseph von. - Wien : Bernina-Verl., 1935

Results - miRWalk

hsa-miR-143-5p . Mirnaid: hsa-miR-143-5p: Mimatid: MIMAT0004599: Sequence: Interactions:

Replica Uhren Shop - Seite 8 von 140 - Replica Uhren ...

Damen 1729. Herren 2731. Unisex 421. Größe. Filter: 20 mm 9. 21 mm 1. 22 mm 4. 24 mm 69. 25 mm 22. 26 mm 15. 27 mm 168. 28 mm 270. 29 mm 27. 30 mm 89. 31 mm 348. 32 mm 109. 33 mm 130. 34 mm 173. 35 mm 127. 36 mm 326. 37 mm 84. 38 mm 256. 39 mm 250. 40 mm 450. 41 mm 448. 42 mm 389. 43 mm 280. 44 mm 273. 45 mm 387. 46 mm 83. 47 mm 30. 48 mm 48. 49 mm 3. 50 mm 8. 53 mm 1. 55 mm 4. Armband Typ ...

CERL Thesaurus

regierte 1680-1729. More Information. Further Biographical Data 22.08.1658-17.12.1729. Activity Personen der Geschichte (Politiker und historische Persönlichkeiten) (16.5p) (sswd) Herzog (gnd) Country Deutschland. Geographic Note DE (iso3166) Place of Activity. Place of Birth Gotha Geburtsort. Gotha Geburtsort. Place of Death Saalfeld/Saale Sterbeort. Saalfeld/Saale Sterbeort. Related Entries ...

1729 Lager | Datenblatt | Preis-Zeano

1729-Inventar, 1729-Preis, 1729-Datenblatt, Adafruit 1729, Zeanoit.com-Online-Händler - Ihr vertrauenswürdiger Partner.

Tussen Kunst & Quarantaine on Instagram: “Another day at ...

10.4k Likes, 73 Comments - Tussen Kunst & Quarantaine (@tussenkunstenquarantaine) on Instagram: “Another day at the office 🙌🏼#tussenkunstenquarantaine #artchallenge #usedprops ️ @purshervil”

CERL Thesaurus

1694-1729 Bischof von Bamberg; 1694-1695 Koadjutor des Erzbischofs von Mainz; 1695-1729 Kurfürst und Erzbischof von Mainz, damit auch Erzkanzler (archicancellarius) des Heiligen Römischen Reichs; begraben im Dom Mainz . More Information. Further Biographical Data 1655 - 1729. 1655-1729. 04.10.1655-01.1729. 04.10.1655-30.01.1729. 1655 - 1729. Dates of Activity 1693 - 1729. Intellectual ...

d-nb.info

00000nz a2200000nc 4500 140032002 DE-101 20181109134158.0 091210n||azznnaabn | aaa |c 140032002 http://d-nb.info/gnd/140032002 gnd (DE-101)140032002 (DE-588)140032002 ...

1729 – Wikipedia

1729 wiar det njüügen-an-twuntigst juar faan det 18. juarhunert. At juar begand mä’n Saninj uun de Gregoriaans kalender. Bejewenhaiden – Feerfaole – Forfåle – Fuarfalen Bäären – Tolaid – Tuläid – Bēren Störwen – Sturwen – Stürwen. Detdiar sidj as tuleetst di 9. Janewoore 2019, am a klook 09:24 feranert wurden. ...

R115 komplett Kit Opel Astra H 5P/SW Z16XEP

R115 komplett Kit Opel Astra H 5P/SW Z16XEP. System Omegas Plus. Verdampfer LiO2. Tank 630×225 30° 52 Liter. Fahrzeugspezifische Gasanlage. Ähnliche Produkte. R115 komplett Kit Opel Meriva Z14XEP € 1.276,00. Enthält 16% MwSt. zzgl. Versand. Lieferzeit: ca. 1-2 Werktage. In den Warenkorb; R115 komplett Kit Renault Clio 2 1,2 D4FD7 € 1.276,00. Enthält 16% MwSt. zzgl. Versand. Lieferzeit ...

Подвесная люстра Favourite 2148-5P


30029.5 RUR
2148-5P Favourite

Favourite / 2148-5P / похожие

Подробнее

Подвесная люстра Favourite 2554-5P


13529.5 RUR
2554-5P Favourite

Favourite / 2554-5P / похожие

Подробнее

Овощерезка As Seen On TV 1729


361 RUR
1729 As Seen On TV

As Seen On TV / 1729 / похожие

Подробнее

Подвесная люстра Favourite 1729-7P


19029.5 RUR
1729-7P Favourite

Favourite / 1729-7P / похожие

Подробнее

Подвесная люстра Favourite 1839-5P


14079.5 RUR
1839-5P Favourite

Favourite / 1839-5P / похожие

Подробнее

Подвесная люстра Favourite 2021-5P


35639.5 RUR
2021-5P Favourite

Favourite / 2021-5P / похожие

Подробнее

Подвесной светодиодный светильник Favourite 2352-5P


31569.5 RUR
2352-5P Favourite

Favourite / 2352-5P / похожие

Подробнее

Подвесной светодиодный светильник Favourite 2421-5P


14079.5 RUR
2421-5P Favourite

Favourite / 2421-5P / похожие

Подробнее

Подвесной светодиодный светильник Favourite 2422-5P


14079.5 RUR
2422-5P Favourite

Favourite / 2422-5P / похожие

Подробнее

TO-220-5 IC Test Socket Transistor TO220-5P TO-5P aging test seat

azs-crimea-service.ru — Каталог цен и описаний на компьютерную и бытовую технику, товары для офис и дома, электронику, товаров для сада и дачи. Мы занимаемся поиском лучших цен в интернет магазинах по всей России, знаем где купить 1729 5P по оптимальной цене в онлайн-магазинах. На нашем сайте azs-crimea-service.ru предоставлена вся необходимая информация для правильной покупки 1729 5P — фотографии товаров, отзывы пользователей, поиск по модели и производителю, наименованию или модели, инструкции по эксплуатации, а так же экспертные обзоры, сайты предлагающие покупу онлайн с доставкой заказа в ваш город.